News, * Jobs *, Resources

Research, Information, BioTech  


  Exact Time


Custom Search




Custom Search


GENOME101 GURU Custom Search on Anything! - Try it now!
  Get a job today!  1000s of Jobs!   Click on any job:  

Mainframes Jobs


COBOL, SysProg, ASM,

Proj Mgrs, QA, Support

Software101 Jobs

JAVA, .NET, C++, C#


Internet, Web dev

 FIRE101 Jobs

Firemen, Volunteer,

EMT, EMS, Emergency,

Firefighters, Chief

 POLICE101 Jobs

Police Officers, Cops

Law Enforcement,

Paralegal, Forensics


Lab Techs, Interns,

Genetics Research, Medical

Genetics Counselor, Biotech

 Nursing101 Jobs

Clinical, Emergency, ICU

LPN, RN, Travel, Home

Nurse Practitioners







    * Latest "Genome-Software" News * 


     Live EBAY Auctions 


Roche GS Junior 454 DNA Genome Sequencer with GS FLX Software
End Date: Wednesday Dec-19-2018 9:16:00 PST
Buy It Now for only: $760.00
Buy It Now | Add to watch list

ROCHE/454 Genome Sequencer GS FLX+ 06372309001 W/ COMPUTER & SOFTWARE
End Date: Friday Dec-21-2018 15:41:08 PST
Buy It Now for only: $1,799.00
Buy It Now | Add to watch list

End Date: Wednesday Jan-2-2019 7:24:41 PST
Buy It Now for only: $125,000.00
Buy It Now | Add to watch list

Roche™ 454 GS Junior® DNA Genome Sequencer with software
End Date: Friday Dec-14-2018 10:54:26 PST
Buy It Now for only: $975.00
Buy It Now | Add to watch list

Illumina MiSeq Genome Sequencer Controller w MiSeq V3.0 C225 software on SSD
End Date: Tuesday Dec-18-2018 12:23:27 PST
Buy It Now for only: $899.00
Buy It Now | Add to watch list

Roche 454 GS Junior Sequencer Genome Sequencing Unit No Software
End Date: Wednesday Dec-12-2018 9:38:33 PST
Buy It Now for only: $1,495.00
Buy It Now | Add to watch list

Illumina Genome Analyser II w/ PEM IIx Paired End Module, Computer and Software
End Date: Sunday Dec-16-2018 4:46:52 PST
Buy It Now for only: $2,730.65
Buy It Now | Add to watch list

     Internet Search Results 


Lists of Genomics Software/Service Providers
This list is intended to be a comprehensive directory of genomics software, genomics-related services and related resources. Some collaborators and I are also working on a more usable and complete resource at:

Quantum Computational Software; Molecular Modeling ...
Q-Chem is a comprehensive ab initio quantum chemistry package for accurate predictions of molecular structures, reactivities, and vibrational, electronic and NMR spectra.

MISA - microsatellite searching tool - IPK Gatersleben
MISA - MIcroSAtellite identification tool This tool allows the identification and localization of perfect microsatellites as well as compound microsatellites which are interrupted by a certain number of bases.

Lists of Genomics Instrument Makers/Consumables Suppliers
This page is devoted to instrument makers, and suppliers of reagents and kits. Let me know if there are other companies that should be listed here.

Green Group - Phrap
Laboratory of PHIL GREEN . CCAGTAATGCACGAGACACAAA +C+++A++GCACG+++CA++++ YCMRYAWKGCACGWSRCASWMR. UW privacy and termsprivacy and terms

Everything Worth Knowing About ... Ancient DNA ...
Ancient DNA has also brought surprises. In 2010, the genome of a pinky bone from Siberia revealed the existence of Denisovans, a previously unknown type of human that lived around the time of Neanderthals.

Guide to Understanding Memory - Practically Networked
Data Formats and Their File Extensions.#24 Printer data file for 24 pin matrix printer (LocoScript) .#ib Printer data file (LocoScript) .#sc Printer data file (LocoScript) .#st Standard mode printer definitions (LocoScript) .$#!

List of File Extensions and Data Formats - Webopedia
Webopedia's list of Data File Formats and File Extensions makes it easy to look through thousands of extensions and file formats to find what you need.



GENOME101.COM --- Genome Information, News, and Resources, Lots More
Need to Find information on any subject? ASK THE GENOME101 GURU! - Images from Wikipedia

 * Contact us:

Copyright � 2007-2013  GENOME101.COM