GENOME101.com 

News, * Jobs *, Resources

Research, Information, BioTech  

 

  Exact Time

 

 
Custom Search

 

 
  

 

Custom Search

 

GENOME101 GURU Custom Search on Anything! - Try it now!
  Get a job today!  1000s of Jobs!   Click on any job:  
 

Mainframes Jobs

z/OS, DB2, CICS, ECM

COBOL, SysProg, ASM,

Proj Mgrs, QA, Support

Software101 Jobs

JAVA, .NET, C++, C#

HTML, PHP, SQL, Linux

Internet, Web dev

 FIRE101 Jobs

Firemen, Volunteer,

EMT, EMS, Emergency,

Firefighters, Chief

 POLICE101 Jobs

Police Officers, Cops

Law Enforcement,

Paralegal, Forensics

 GENETICS101 Jobs

Lab Techs, Interns,

Genetics Research, Medical

Genetics Counselor, Biotech

 Nursing101 Jobs

Clinical, Emergency, ICU

LPN, RN, Travel, Home

Nurse Practitioners

 

 

 
  

 

 

 

    * Latest "Genome-Software" News * 

 

     Live EBAY Auctions 

 

Roche GS Junior 454 DNA Genome Sequencer with GS FLX Software
$636.50
End Date: Saturday May-18-2019 10:16:00 PDT
Buy It Now for only: $636.50
Buy It Now | Add to watch list

ILLUMINA HiSeq LABORATORY DNA GENOME SEQUENCER ANALYZER DELL SERVER PC SOFTWARE
$115,000.00
End Date: Wednesday May-15-2019 7:20:11 PDT
Buy It Now for only: $115,000.00
Buy It Now | Add to watch list

Illumina MiSeq Genome Sequencer Controller w MiSeq V3.0 C225 software on SSD
$899.00
End Date: Friday May-17-2019 13:23:27 PDT
Buy It Now for only: $899.00
Buy It Now | Add to watch list

Roche 454 GS Junior Sequencer Genome Sequencing Unit No Software
$1,196.00
End Date: Thursday May-16-2019 9:16:05 PDT
Buy It Now for only: $1,196.00
Buy It Now | Add to watch list

UNDERSTANDING THE HUMAN GENOME PROJECT CD ROM (Mac & Windows) New & Sealed
$12.00
End Date: Thursday May-2-2019 5:17:37 PDT
Buy It Now for only: $12.00
Buy It Now | Add to watch list

Media Factory Dt Rose Of Genome Gameboy Software
$153.99
End Date: Thursday May-16-2019 7:26:43 PDT
Buy It Now for only: $153.99
Buy It Now | Add to watch list

Media Factory Dt Rose Of Genome Gameboy Software
$143.99
End Date: Sunday May-19-2019 23:45:44 PDT
Buy It Now for only: $143.99
Buy It Now | Add to watch list

ROCHE/454 Genome Sequencer GS FLX+ 06372309001 W/ COMPUTER & SOFTWARE
$999.00
End Date: Monday Apr-22-2019 13:50:29 PDT
Buy It Now for only: $999.00
Buy It Now | Add to watch list

     Internet Search Results 

  

Lists of Genomics Software/Service Providers
This list is intended to be a comprehensive directory of genomics software, genomics-related services and related resources. Some collaborators and I are also working on a more usable and complete resource at:

MISA - microsatellite searching tool - IPK Gatersleben
MISA - MIcroSAtellite identification tool This tool allows the identification and localization of perfect microsatellites as well as compound microsatellites which are interrupted by a certain number of bases.

MISA - microsatellite searching tool - IPK Gatersleben
Primer3 interface modules Download p3_in.pl - creates the Primer3 input file Download p3_out.pl - parses the Primer3 output file. These perl scripts are an example of how an interaction with the results obtained by the microsatellite search using the MISA tool and the primer modelling software Primer3 (Whitehead Institute) may work in order to design primers flanking the microsatellite locus.

Quantum Computational Software; Molecular Modeling ...
Q-Chem: Chemistry software, theoretical chemistry and quantum Chemistry software for research, visualization, quantum calculation and molecular modeling

Nutrition Genome | DNA Test Kit & Health Report
Nutrition Genome offers the most comprehensive analysis on the market, covering 85+ clinically relevant genes across all of the major biochemical pathways.

Green Group - Phrap
Laboratory of PHIL GREEN . CCAGTAATGCACGAGACACAAA +C+++A++GCACG+++CA++++ YCMRYAWKGCACGWSRCASWMR. UW privacy and termsprivacy and terms

Roary: the pan genome pipeline - GitHub Pages
Abstract. By Andrew Page based on version 3.11.2 (22-Jan-2018) Roary is a high speed stand alone pan genome pipeline, which takes annotated assemblies in GFF3 format (produced by Prokka (Seemann, 2014)) and calculates the pan genome.

File Extension : 네이버 블로그 - blog.naver.com
.A UNIX Library [UNIX].A01 ARJ Multi-volume Compressed Archive (can be 01 to 99).A01 - .A10 OzWin CompuServe E-mail/Forum Access SYSOP File.A06 Lotto Pro 2002 Smart Number Ticket

 

 

GENOME101.COM --- Genome Information, News, and Resources, Lots More
Need to Find information on any subject? ASK THE GENOME101 GURU! - Images from Wikipedia

 * Contact us:  support@z101.com
 
                                  

Copyright � 2007-2013  GENOME101.COM