GENOME101.com 

News, * Jobs *, Resources

Research, Information, BioTech  

 

  Exact Time

 

 
Custom Search

 

 
  

 

Custom Search

 

GENOME101 GURU Custom Search on Anything! - Try it now!
  Get a job today!  1000s of Jobs!   Click on any job:  
 

Mainframes Jobs

z/OS, DB2, CICS, ECM

COBOL, SysProg, ASM,

Proj Mgrs, QA, Support

Software101 Jobs

JAVA, .NET, C++, C#

HTML, PHP, SQL, Linux

Internet, Web dev

 FIRE101 Jobs

Firemen, Volunteer,

EMT, EMS, Emergency,

Firefighters, Chief

 POLICE101 Jobs

Police Officers, Cops

Law Enforcement,

Paralegal, Forensics

 GENETICS101 Jobs

Lab Techs, Interns,

Genetics Research, Medical

Genetics Counselor, Biotech

 Nursing101 Jobs

Clinical, Emergency, ICU

LPN, RN, Travel, Home

Nurse Practitioners

 

 

 
  

 

 

 

    * Latest "Chromosome" News * 

 

     Live EBAY Auctions 

 

3 BOOKS - ROBIN COOK - COMA - CHROMOSOME 6 - TOXIN
$9.99
End Date: Sunday Dec-23-2018 7:12:57 PST
Buy It Now for only: $9.99
Buy It Now | Add to watch list

Understanding the "Why" Chromosome by Guisewite, Cathy
$3.68
End Date: Sunday Jan-6-2019 0:55:44 PST
Buy It Now for only: $3.68
Buy It Now | Add to watch list

Mens Nike Lebron XII Chromosome Blue Lagoon Pink Size 11
$68.00 (0 Bids)
End Date: Sunday Dec-16-2018 12:01:42 PST
Buy It Now for only: $110.00
Buy It Now | Bid now | Add to watch list

6 RARE Drosophila melanogaster Salivary Chromosome Map DNA 1934 1938-39 1941-42
$19.00
End Date: Sunday Jan-6-2019 10:04:55 PST
Buy It Now for only: $19.00
Buy It Now | Add to watch list

Chromosome Abnormalities and Genetic Counseling (O
$7.02
End Date: Monday Dec-24-2018 11:34:19 PST
Buy It Now for only: $7.02
Buy It Now | Add to watch list

Chromosome 6 (A Medical Thriller) by Cook, Robin
$2.98
End Date: Friday Jan-4-2019 23:28:23 PST
Buy It Now for only: $2.98
Buy It Now | Add to watch list

Chromosome 6 by Cook, Robin, Good Book
$1.00
End Date: Thursday Jan-10-2019 3:47:05 PST
Buy It Now for only: $1.00
Buy It Now | Add to watch list

Chromosome 6 [A Medical Thriller]
$3.39
End Date: Friday Jan-4-2019 6:18:07 PST
Buy It Now for only: $3.39
Buy It Now | Add to watch list

Chromosome 6 by Robin Cook (1998, Paperback)
$1.50
End Date: Friday Dec-14-2018 17:16:20 PST
Buy It Now for only: $1.50
Buy It Now | Add to watch list

Chromosome 6, Robin Cook,0425161242, Book, Acceptable
$3.79
End Date: Friday Jan-4-2019 1:41:31 PST
Buy It Now for only: $3.79
Buy It Now | Add to watch list

NEON GENESIS EVANGELION ANGEL CHROMOSOME XX ANIME ACTION FIGURE WITH PACKAGING
$23.99
End Date: Wednesday Dec-19-2018 5:34:40 PST
Buy It Now for only: $23.99
Buy It Now | Add to watch list

Chromosome 6 by Robin Cook (1998, Paperback)
$1.95
End Date: Friday Dec-28-2018 20:10:47 PST
Buy It Now for only: $1.95
Buy It Now | Add to watch list

Chromosome Biology by Appels Morris Gill May Hardcover
$78.88
End Date: Saturday Dec-29-2018 3:36:17 PST
Buy It Now for only: $78.88
Buy It Now | Add to watch list

Chromosome 6 [A Medical Thriller]
$4.50
End Date: Sunday Dec-23-2018 10:12:00 PST
Buy It Now for only: $4.50
Buy It Now | Add to watch list

Chromosome 6 by Robin Cook (1998, Paperback)
$3.73
End Date: Friday Dec-14-2018 11:56:53 PST
Buy It Now for only: $3.73
Buy It Now | Add to watch list

     Internet Search Results 

  

Chromosome - Wikipedia
A chromosome (/ ˈ k r oʊ m ə ˌ s oʊ m, -ˌ z oʊ m /; from Ancient Greek: χρωμόσωμα, chromosoma, chroma means colour, soma means body) is a DNA molecule with part or all of the genetic material of an organism.Most eukaryotic chromosomes include packaging proteins which, aided by chaperone proteins, bind to and condense the DNA molecule to prevent it from becoming an unmanageable ...

Y chromosome - Wikipedia
The Y chromosome is one of two sex chromosomes in mammals, including humans, and many other animals.The other is the X chromosome.Y is the sex-determining chromosome in many species, since it is the presence or absence of Y that determines the male or female sex of offspring produced in sexual reproduction.In mammals, the Y chromosome contains the gene SRY, which triggers testis development.

Chromosome - Atlas of Genetics and Cytogenetics in ...
Chromosome : Genes, Leukemias, Solid Tumors, and Cancer-Prone Diseases located on Chromosome reviewed and published in the Atlas of Genetics and Cytogenetics in Oncology and Haematology

Chromosome-6-Deletion-Information
Chromosome 6 Deletions: A chromosome 6 deletion is a rare disorder in which some of the genetic material that makes up one of the body’s 46 chromosomes – specifically chromosome 6 in this case – is missing.

Biology 442, Human Genetics - Chromosome Abnormalities
Biology 442 - Human Genetics Chromosome Abnormalities: Autosomes and Sex Chromosomes. Chromosome Deletion. Rare Chromosome Disorders. Chromosome aberrations are classified as one of two types: numerical or structural.

Basic Genetics
We’re asking for your help. For over 20 years, the Learn.Genetics website has provided engaging, multimedia educational materials at no cost. Learn.Genetics is one of the most-used science websites. Tens of millions of visitors come to our site each year to find the science and health information ...

Cell Size and Scale - Learn.Genetics
How can an X chromosome be nearly as big as the head of the sperm cell? No, this isn't a mistake. First, there's less DNA in a sperm cell than there is in a non-reproductive cell such as a skin cell.

Human Genome: First 1000 lines of Chromosome 1
human genome: first 1000 lines of chromosome 1 gatcaatgaggtggacaccagaggcggggacttgtaaataacactgggctgtaggagtga ...

Animation - Sumanas, Inc.
SOURCE: Sadava, et al., Life: The Science of Biology, Ninth Edition, Sinauer Associates © 2010 Sinauer Associates, W. H. Freeman & Co., and Sumanas, Inc. KEYWORDS ...

Basic Principles of Genetics: Glossary of Terms
alternate forms or varieties of a gene.The alleles for a trait occupy the same locus or position on homologous chromosomes and thus govern the same trait. However, because they are different, their action may result in different expressions of that trait.

 

 

GENOME101.COM --- Genome Information, News, and Resources, Lots More
Need to Find information on any subject? ASK THE GENOME101 GURU! - Images from Wikipedia

 * Contact us:  support@z101.com
 
                                  

Copyright � 2007-2013  GENOME101.COM